• Users Online: 741
  • Print this page
  • Email this page


 
 
Table of Contents
ORIGINAL ARTICLE
Year : 2021  |  Volume : 9  |  Issue : 4  |  Page : 252-258

Anatomical and genetic identification of two Euphorbia species


1 Dravyaguna Department, Gujarat Ayurved University, Jamnagar, Gujarat, India
2 Pharmacognosy Laboratory, Gujarat Ayurved University, Jamnagar, Gujarat, India
3 Department of Microbiology, Viral Research & Diagnostic Laboratory (VRDL), Belagavi Institute of Medical Sciences, Belagavi, Karnataka, India
4 Regional Ayurveda Institute for Fundamental Research (RAIFR), Kothrud, Pune, Maharashtra, India

Date of Submission07-Jan-2021
Date of Decision15-Nov-2021
Date of Acceptance08-Oct-2021
Date of Web Publication29-Dec-2021

Correspondence Address:
Prof. Rabinarayan Acharya
Dravyaguna Department, Gujarat Ayurved University, Jamnagar, Gujarat.
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/jism.jism_1_21

Rights and Permissions
  Abstract 

Background: Euphorbia antiquorum L. and Euphorbia neriifolia L. belong to the family Euphorbiaceae. E. antiquorum and E. neriifolia are considered as botanical source of Tridhara Snuhi and Snuhi, respectively. E. antiquorum has been reported for its anticancer effect in different cancer cell lines and E. neriifolia is traditionally used in the management of digestive problem, respiratory problem, etc. The present study was designed to evaluate anatomical and genetic characterization of E. antiquorum and E. neriifolia. Material and Methods: Anatomical evaluation was assessed through macroscopic and microsopic evaluation of stem and leaf of both the plants, whereas genetic characterization was examined through DNA barcoding analysis of leaf sample of both the plants. Result: Both plants are xerophytic in nature and bear a good amount of milky white latex, and shrub to small tree in nature. Microscopically, stem and leaf of both the plants contain latex duct in transverse section. All these characters highlights the key characters of family Euphorbiaceae. DNA barcoding confirms the molecular identity of both the plants. Conclusion: Data specified in the present study regarding anatomical and genetic characters will help for easy identification of both the plants, that is, Euphorbia antiquorum L. and Euphorbia neriifolia L.

Keywords: Barcoding, Euphorbia antiquorum, Euphorbia neriifolia, Euphorbiaceae, Snuhi kshira, Tridhara snuhi


How to cite this article:
Acharya R, Roy S, Harisha CR, Hegde S, Ranade A. Anatomical and genetic identification of two Euphorbia species. J Indian Sys Medicine 2021;9:252-8

How to cite this URL:
Acharya R, Roy S, Harisha CR, Hegde S, Ranade A. Anatomical and genetic identification of two Euphorbia species. J Indian Sys Medicine [serial online] 2021 [cited 2022 Jan 28];9:252-8. Available from: https://www.joinsysmed.com/text.asp?2021/9/4/252/334267




  Introduction Top


The use of herbs as medicine comprises one of the most ancient forms of health care. Adulteration and substitution of herbal drugs with an inferior quality material can be prevented only by possessing adequate knowledge pertaining to the identification and authentication of plant drugs. Detailed knowledge of plant anatomy is necessary to evaluate the identity and quality of the plant drugs. Macroscopic and macroscopic evaluation is one of the important pharmacognostical indices to establish the identity and quality of herbal drugs. Another such important plant identification and authentication technique is DNA barcoding. The DNA barcode is a short sequence of genes, and it is used as a standard tool to identify the species to which an organism belongs. The main aim of DNA barcoding analysis is to provide a simple and automatic method to properly identify species.[1],[2],[3]

Euphorbia antiquorum L. and Euphorbia neriifolia L. belong to the family Euphorbiaceae, and they are commonly known as the botanical source of tridhara snuhi and snuhi, respectively.[4],[5]

E. antiquorum has inhibitory effects on several different cancer cell lines. It also has insecticidal activity. Traditionally, its fresh milky latex or gum is used as an acrid irritant that is applied externally to relieve warts and other cutaneous infections and also to relieve pain of gout, rheumatism and toothache.[6],[7]

E. neriifolia is bitter, laxative, carminative, acrid, and pungent; it improves appetite, is an abortifacient, a digestive, an expectorant, depurative, febrifuge, stomachic, vermifuge; and is useful in abdominal trouble, bronchitis, tumors, loss of consciousness, asthma, leukoderma, piles, inflammation, enlargement of spleen, anemia, ulcers, cutaneous diseases, dropsy, dyspepsia, pain, flatulence intermittent fever, in chronic respiratory trouble, etc.[8]

The present study has been designed to set the identification and authentication parameters of two latex-bearing plants, that is, Euphorbia antiquorum L. and Euphorbia neriifolia L. through macro–microscopic examination and DNA barcoding analysis.


  Materials and Methods Top


Plant Authentication

Both plants, that is, Euphorbia antiquorum L. and Euphorbia neriifoilia L., were collected by the first and second authors from one of their natural habitats, Jamnagar, Gujarat and Barddhaman, West Bengal, respectively, during the months of October to December, 2015. The plant was identified by local taxonomists, and the botanical identification was confirmed by studying the morphological characters of various parts and comparing them with various characters described in different kinds of flora and books. Color photographs were taken, and wet specimens of the sample were prepared following standard guidelines. Sample specimens were authenticated by experts of the pharmacognosy laboratory of Gujarat Ayurved University, Jamnagar; wet specimens of the sample (Specimen No. PHM/2015–2016/6269 and PHM/2015–2016/6271 for Euphorbia antiquorum L. and Euphorbia neriifoilia L., respectively) were deposited at the institute’s pharmacognosy laboratory for further referencing.

Macroscopic and Microscopic Evaluation

Fresh plant parts, that is, the leaf and stem of both plants, namely Euphorbia antiquorum L. and Euphorbia neriifolia L., were subjected for a detailed macroscopic and microscopic study. Macroscopic characters of all plants were studied as per visual observation, following standard procedures of taxonomy.[9],[10]

Thin free-hand TSs of leaf and stem were taken, observed with distilled water, then stained with phloroglucinol (20 mg/mL of alcohol) along with hydrochloric acid (6N), and again examined to assess different cellular structure and content. The samples were observed under a compound microscope (QUASMA, India), and photographs were taken by using Kodak easy share C140, 8.2 megapixels 3× optical/5× digital zoom HD camera.[11]

Barcoding Analysis

DNA isolation

Fresh leaves of Euphorbia antiquorum L. and Euphorbia neriifolia L. were detached from the respective plant and cleaned with water. Genomic DNA was extracted from leaf samples of all the collected plants individually using the modified CTAB method. The quantity and purity of DNA was measured using a spectrophotometer and by 1% agarose gel electrophoresis. The final dilution was made up to 50 ng/μL with TE buffer (10mM Tris HCI, pH 8.0, and 0.1 mM EDTA, pH 8.0) and stored at −20°C.[12]

PCR amplifications

Amplification of rbcL region was performed in Veriti Thermal Cycler (Applied Biosystems). The 50-μL reaction mixture contained 50 ng genomic DNA, 10 μM primer, 25 μL of Taq Master Mix Red with 1.5 mM MgCl2 (AMPLIQON). Two primers, that is rbcL forward Primer (ATGTCACCACAAACAGAGACTAAAGC) and rbcL reverse Primer (GTAAAATCAAGTCCACCRCG), were used for rbcL amplification.[13],[14] To enhance and facilitate the PCR amplification, DMSO (100%) was used in each assay. PCR amplification conditions were: 98°C for 45 s, 98°C for 10 s, 55°C for 30 s, 72°C for 40 s with 35 cycles, and 72°C for 10 min. PCR products were sequenced after confirming amplification in 1% agarose gel electrophoresis, and purified using Mini Elute PCR Purification Kit (Qiagen).

Sequencing and phylogenetic tree

Sequence data obtained were analyzed, and a consensus sequence was generated from forward and reverse sequences using aligner software. This sequence was subjected to BLAST with NCBI gene bank database. Based on maximum identity score, the first ten identities were considered and the samples were identified. A phylogenetic tree was also constructed for these sequences.


  Results and Discussion Top


Euphorbia antiquorum L.

Macroscopic study

The plant is xerophytic in nature and bears a good amount of milky white latex. Plant is a fleshy shrub or small tree about 4-8 m long with armed branches. Plant bears pedicelled cyathium of green color [Figure 1]A–C.
Figure 1: Transverse section of Euphorbia antiquorum L. stem. Co.rg = cortex region, Ep = epidermis, Lt.dc = latex duct, Ph = phloem, Su.st = Sunken stomata, Xy = xylem

Click here to view


Stem

Type: Branched with a proper node, subsucculent, thick, three to five winged; size: 1–1.5 cm; shape: winged, wings repand sinuate with short stipullar spines; fracture: elastic, fibrous; texture: smooth; color: green; odor: slightly pungent; spines: straight, paired, stipullar spine, about 1–2 cm long.

Leaves

Type: simple, at the end of the branch, small and fugacious, fleshy; shape: obovate-oblong; size: 0.5–1 cm long; margin: entire; base: sessile, semi-cordate; apex: acute; touch: smooth; color (both upper and lower): lower surface lighter green than upper surface; venation: reticulate.

Microscopic study

T.S. of stem

TS of E. antiquorum phylloclade displays three distinct regions, namely cortical tissue, vascular cylinder, and the pith region [Figure 1D–M].

Epidermis: Epidermis is an outmost layer with a single layer of cells, protected with a thick cuticle. The epidermal cells have conspicuous thick walls and possess conical-shaped papillae. The sub-epidermal layer is composed of quadrangular and rectangular shaped cells. The dimensions of the sub-epidermal cells are comparatively greater than those of typical epidermal cells. The epidermal layer is interrupted by sunken stomata. Cortex: The cortical region is organized comprising two distinct regions, namely an outer chlorophyllous palisade-like tissue and an inner ground parenchyma. Chlorophyllous palisade tissue consists of a few layers and occupies a chief proportion of the cortex. Palisade cells are positioned perpendicularly to the surface with copious intercellular spaces. The ground parenchyma comprises more than three cell layers directly over the vascular region. The cells of the ground parenchyma appear isodiametric in shape with thin walls. The ground parenchyma tissue is filled with chlorophyll pigments, latex tubes/laticiferous canals, starch grains, yellow content, brown content, and prismatic crystals. Laticiferous cell/latex ducts: Numerous large central cavities are found in ground parenchyma. Laticiferous canals/latex tube/laticifer cells are made up of distinguished round to oval-shaped parenchyma cells that are filled with latex, and these are found all over the ground tissue but the frequency is higher toward the vascular bundle region. The size of the primary laticifer cells can be easily characterized from the neighboring parenchymatous cells by their dark staining content. Vascular bundle: The vascular system is collateral, radial developing a ring in which the xylem is innermost and the phloem is outermost and formed by typical large cells. The vascular system contains a large number of xylem elements, massive radial parenchyma, and several large sieve cells. Pith: The pith region contains large, rectangular, thin-walled parenchyma cells with copious intracellular spaces, with no central cavity present.

Barcoding Analysis

The aligned sequences of the taxonomically identified Euphorbia antiquorum sample was queried for highly similar sequences in GenBank using nucleotide BLAST Tool from National Center for Biotechnology Information (NCBI). Results of Blast sequence and Phylogenetic tree showed that the sample sequences (amplification of rbcL region) were best matching with Euphorbia antiquorum (Gene Bank Accession LC438912.1), with 94% query cover, 0.0 E value, and 99.46% Ident. Therefore, the sequence derived from this study confirms its identification as Euphorbia antiquorum.

Phylogenetic tree

{Figure 3}

Euphorbia neriifolia L.

Macroscopic study

The plant is xerophytic in nature and bears a good amount of milky white latex. Plant is a fleshy shrub or small tree about 4-8 m long with armed branches. Plant bears pedicelled cyathium of green color [Figure 2]A–C.{Figure 2}

Stem

Type: branched with proper node and internodes, succulent. Branches upward with tubercles in five irregular rows; size: 14–21 mm; shape: cylindrical; fracture: elastic, fibrous; texture: smooth; color: green; odor: slightly pungent; spines: pairs of sharp stipular spines arising from thick tubercles.

Leaves

Type: fleshy, alternate; shape: spathulately ovate; size: 1–2 inches; margin: entire; base: short petiolate, tapering toward ends; apex: obtuse; touch: smooth, glabrous; color (both upper and lower): lower surface in lighter than upper; venation: reticulate.

Microscopic study

T.S. of stem

Diagrammatic section of the stem is circular with an outer epidermis, a middle cortex region followed by a vascular bundle and a centrally located large pith [Figure 2D–I].

Epidermis: TS TS of stem shows a single-layered epidermis composed of thick-walled, barrel-shaped cells that are covered externally by a thick cuticle. The epidermal layer is somewhat filled with yellow and brown content and interrupted by sunken stomata. An innermost sub-epidermal layer is formed with quadrangular and rectangular cells. Sub-epidermal cell dimensions are greater than those of typical epidermal cells. Cortex: Immediately after the sub-epidermal layer, the cortical region forms chlorophyllous palisade-like tissue and ground parenchyma tissue with numerous intercellular spaces. Eight to ten layers of chlorophyllous palisade layers that are formed by parenchyma cells, perpendicularly to the surface, are loaded with chlorophyll pigments followed by oval to round-shaped parenchymatous ground tissue. Vascular bundle: The vascular bundle is collateral, radial forming a ring in which the xylem is innermost, abundant and the phloem is outermost and formed by distinctive large cells. The xylem is made up of xylem parenchyma and its fiber and phloem are made up of phloem parenchyma and sieve elements. Parenchymatous cells surrounding the vascular bundle along with the vascular system embedded with an ample amount of Iodine-stained starch grains. Pith: Centrally located pith comprises irregular-shaped, network-like, and loosely arranged thin-walled oval to rounded-shaped parenchyma cells and is filled with a few starch grains. Laticiferous cell/latex ducts: Laticiferous cells comprise a bicollateral to vascular bundle and are made up of round to oval parenchyma cells; these are filled with latex and are mostly observed around the vascular bundle, that is the frequency is higher in the ground cortical parenchyma toward the vascular bundle followed by the vascular bundle and a very few in the pith region.

T.S. of leaf

Diagrammatic section of leaf shows the upper and lower epidermis followed by palisade and spongy parenchyma in lamina whereas the ground tissue is centrally located in a “V” shaped vascular bundle in the midrib [Figure 2J–O].

Phylogenetic tree

{Figure 4}

Epidermis: TS of midrib shows an upper and a lower single-layered compactly arranged barrel-shaped epidermis with a thick cuticle, mostly filled with yellow to brown content and interrupted by sunken stomata. Ground tissue: Ground tissue is made up of parenchymatous cells and embedded with prismatic crystals, yellow and brown content. Vascular bundle: Vascular bundles are arranged in a “V” shape, situated at the center of the midrib. The vascular bundle is open and collateral, and it is made up of xylem parenchyma and its fiber. The xylem is situated toward the upper epidermis, and the phloem is situated toward the lower epidermis. Mesophyll: The lamina shows a dorsiventral structure. The mesophyll is composed of compactly arranged upper palisade and lower spongy parenchyma cells. The palisade parenchyma consists of 8–12 layers of elongated cells, loaded with chlorophyll pigment and rarely with calcium oxalate crystals. Some of the cells below the epidermis are embedded with coloring matter. The lower spongy parenchyma consists of starch grain and prismatic crystals of calcium oxalate and crystalline materials. Some of the vascular strands pass through the mesophyll tissue. Laticiferous cell/latex ducts: Laticiferous cells are found mostly at the region of the vascular bundle and at the portion of lower spongy parenchyma cells.

Barcoding Analysis

The aligned sequences of taxonomically identified Euphorbia neriifolia sample was queried for highly similar sequences in GenBank using nucleotide BLAST Tool from National Center for Biotechnology Information (NCBI). Results of Blast sequence and Phylogenetic tree showed that the sample sequences (amplification of rbcL region) were best matching with different Euphorbia spp (Gene Bank Accession KF408916.1), with 98% query cover, 0.0 E value, and 99.81% Ident.


  Conclusion Top


Macroscopic study showed that both the plants are shrubs to small trees. Plants bear a pedicelled cyathium of green color. Stems of E. antiquorum are subsucculant, three to five winged with elastic, fibrous fracture. E. neriifolia stems are succulent, circular, erect, and slender with an elastic fibrous fracture. Stem of both plants bears paired, acute, sharp spine, present over the corky base. Young stem is dark reddish brown in color, afterwards it turns blackish brown on its maturity. Both the plants are xerophytic in nature and bear a good amount of milky white latex. Microscopic characters showed the occurrence of laticiferous tubes or laticiferous ducts and in both stem and leaf of both the species. DNA barcoding confirms the identity of Euphorbia spp. at the genetic molecular level, which adds to standardization parameters. These parameters will help to set the identity of the plants Euphorbia antiquorum L. Euphorbia neriifolia L.

Acknowledgments

The authors would like to thank the National Medicinal Plant Board, Ministry of AYUSH, New Delhi for the funds under the research project. The authors are also indebted to the Gujarat Ayurved University for providing the facility to conduct the whole research work.

Financial Support and Sponsorship

The work was supported by the National Medicinal Plant Board, Ministry of AYUSH, New Delhi.

Conflicts of Interest

There are no conflicts of interest.



 
  References Top

1.
Patwekar SL, Suryawanshi Arvind B, Gaikwad Manoj S, Pedewad Snehal R, Potulwar Ashwini P. Standardization of herbal drugs: An overview. Pharma Innov J2015;4:100-4.  Back to cited text no. 1
    
2.
Bekbolatova EN, Kurbatova NV, Sakipova ZB,Ibragimova LN, Alpysbayeva SI,Kabdenova ATet al. Macroscopic and microscopic diagnostic features of the potential herbal drug Crataegus Almaatensis Pojark endemic in Kazakhstan. Iran J Pharm Sci2018;14:39-50.  Back to cited text no. 2
    
3.
Saukel J, Ginko E. Microscopic analysis of plants. In: Meyers RA, editor. Encyclopedia of Analytical Chemistry; 2014. p. 1-54. https://doi.org/10.1002/9780470027318.a9906.  Back to cited text no. 3
    
4.
Nishteswar K, Hemadri K. Dravyagunavijnana. 1st ed. Delhi: Chaukhambha Sanskrit Pratisthan; 2010.  Back to cited text no. 4
    
5.
Bhavmishra. Guduchyadi Varga, shloka 67-72, In: Chunekar KC, editors. Bhavaprakash Nighantu. Varanasi: Chaukhambha Bharati Academy; 2010. p. 289-92.  Back to cited text no. 5
    
6.
Prashant Y, Kritika S, Anurag M. A review on phytochemical, medicinal and pharmacological profile of Euphorbia antiquorum. Int J Pharm Pharm Res 2015;4:56-67.  Back to cited text no. 6
    
7.
Kumar A, Saikia D. Euphorbia antiquorum Linn: A comprehensive review of ethnobotany, phytochemistry and pharmacology. J Anal Pharm Res 2016;2:1-5.  Back to cited text no. 7
    
8.
Thorat BR, Bolli V. Review on Euphorbia neriifolia plant. Biomed J Sci Tech Res 2017;1:1723-32.  Back to cited text no. 8
    
9.
Saxena HO, Brahmam M. Flora of Orrisa. Vol. 3. Bhubaneswar:Orissa Forest Development Corporation Ltd.; 1995.  Back to cited text no. 9
    
10.
Hooker JD, KCSI CB. The Flora of British India. Vol V. London: L Reeve & Co.; 1890. p. 255.  Back to cited text no. 10
    
11.
Khandelwal KR. Practical Pharmacognosy. 19th ed. Pune: Nirali Prakashan; 2008. p. 9-19.  Back to cited text no. 11
    
12.
Richards E, Reichardt M, Rogers S. Preparation of genomic DNA from plant tissue. In: Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K, editors. Curr Protoc Mol Biol. New York, USA: John Wiley & Sons; 1994.  Back to cited text no. 12
    
13.
Kress WJ, Erickson DL, Jones FA, Swenson NG, Perez R, Sanjur O, et al. Plant DNA barcodes and a community phylogeny of a tropical forest dynamics plot in panama. Proc Natl Acad Sci U S A 2009;106:18621-6.  Back to cited text no. 13
    
14.
Levin RA, Wagner WL, Hoch PC, Nepokroeff M, Pires JC, Zimmer EA, et al. Family-level relationships of Onagraceae based on chloroplast rbcL and ndhF data. Am J Bot 2003; 90:107-15.  Back to cited text no. 14
    


    Figures

  [Figure 1]



 

Top
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

 
  In this article
Abstract
Introduction
Materials and Me...
Results and Disc...
Conclusion
References
Article Figures

 Article Access Statistics
    Viewed272    
    Printed4    
    Emailed0    
    PDF Downloaded31    
    Comments [Add]    

Recommend this journal